TotalSeq™-A0124 anti-human CD31 Antibody

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq?-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume. Refer to the corresponding TotalSeq? protocol for specific staining instructions.

Clone WM59 has been reported to recognize the D2 extracellular portion of CD31.

Additional reported applications (for the relevant formats) include: immunofluorescence microscopy², immunohistochemical staining of acetone-fixed frozen tissue sections⁸,　blocking of platelet aggregation³, and spatial biology (IBEX)^11,12. Clone WM59 is not recommended for immunohistochemical staining of formalin-fixed paraffin-embedded sections. The Ultra-LEAF? purified antibody (Endotoxin < 0.01 EU/?g, Azide-Free, 0.2 ?m filtered) is recommended for functional assays (Cat. No. 303143 & 303144).

The purified WM59 antibody is useful as a capture antibody for a sandwich ELISA assay, when used in conjunction with biotin anti-human CD31 antibody (Cat. No. 536604) antibody as the detection antibody.

TotalSeq? reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our　Scientific Poster Library.

1. Schlossman S, et al. Eds. 1995. Leucocyte Typing V Oxford University Press. New York.
2. Muczynski KA, et al. 2003. J. Am. Soc. Nephrol. 14:1336. (IF)
3. Wu XW, et al. 1997. Arterioscl. Throm. Vas. 17:3154. (Block)
4. Nagano M, et al. 2007. Blood 110:151. (FC) PubMed
5. MacFadyen JR, et al. 2005. FEBS Lett. 579:2569. PubMed
6. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
7. Sestak K, et al. 2007. Vet. Immunol. Immunopathol. 119:21.
8. Wicki A, et al. 2012. Clin. Cancer Res. 18:454. (FC, IHC) PubMed
9. Oeztuerk-Winder F, et al. 2012. EMBO J. 31:3431. (FC) PubMed
10. Bushway ME, et al. 2014. Biol Reprod. 90(5): 110 (IF) PubMed
11. Radtke AJ,　et al. 2020.　Proc Natl Acad Sci USA. 117:33455-33465. (SB)　PubMed
12. Radtke AJ,　et al. 2022.　Nat Protoc. 17:378-401. (SB)　PubMed

1. Hao Y, et al. 2021. Cell. 184:3573. PubMed

Monocytes, platelets, granulocytes, endothelial cells, lymphocyte subset

1. DeLisser H, et al. 1994. Immunol. Today 15:490.
2. Newman P, 1997. J. Clin. Invest. 99:3.
3. Fawcett J, et al. 1995. J. Cell Biol. 128:1229.